rs7793372 chr7:14507824 C>T
- Sequence
ggaggggaaagagccaaaaaaaca[C/T]gtgagtcaactgtgggtactgatg
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- HTF4_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | -1.09 | 2.73 | 2.00 | n/a | No Hit | |||
| NFIC_HUMAN | -0.03 | 2.41 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, rheumatoid arthritis, total cholesterol change with statins, triglycerides change with statins