rs7794304 chr7:28388772 T>C
- Sequence
gcataatgcctcaactcttagagc[T/C]ggcatttgttgtatcagtcctaat
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 0.18 | 1.61 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, arthritis including non-rheumatoid, coronary artery disease (cad), fasting blood glucose, fasting insulin, homa-ir, infant head circumference, longstanding arthritis, rheumatoid arthritis, years of education