rs7795239 chr7:88289752 G>A
- Sequence
atatcctgaatgggtgtcatcaaa[G/A]gtcatgaccacatgtggggaagta
- ASB in cell types
- 22RV1 (prostate carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.72 | n/a | 4.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.07 | -4.47 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition) (females), obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood