rs7796222 chr7:19587579 A>C
- Sequence
aacctcagtcctgcaactgcagaa[A/C]acttcttccaacaacctgagtaaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.18 | 2.26 | 1.93 | n/a | No Hit |
Items per page:
1 – 1 of 1