rs7796298 chr7:155373988 C>G
- Sequence
gcaatgtccccggtgccccagacc[C/G]gcactccgctgcctcctggcttct
- ASB in cell types
- GM23248 TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 0.47 | 1.83 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.14 | 1.68 | 1.00 |
Items per page:
1 – 2 of 2