rs7797030 chr7:5570373 G>T
- Sequence
cgcggatgagccgcggccgccacg[G/T]gggggtcgtagtagtgactgcgac
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) NGP (neuroblastoma)
- ASB for transcription factors
- MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYCN_HUMAN | -2.11 | 2.53 | 1.00 | 7.96 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
