rs7797315 chr7:35256265 C>A
- Sequence
ctgtttcctcctcctttccaagtg[C/A]ctacgcggccttagcccagctctg
- ASB in cell types
- HDF(human dermal fibroblasts)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 0.71 | 1.85 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Heart_Atrial_Appendage, Heart_Left_Ventricle, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood