rs7798321 chr7:129164200 A>G
- Sequence
tcagtcaacaagtattttgtgata[A/G]tagcattcagagatagatacacat
- ASB in cell types
- MDA-MB-157 (triple negative breast carcinoma) A549 (lung carcinoma) transverse colon CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-157 (triple negative breast carcinoma) | 0.05 | 2.88 | 2.00 | |||
| A549 (lung carcinoma) | -0.09 | 0.95 | 2.00 | |||
| transverse colon | 1.56 | 0.30 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.38 | 0.74 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, height, rheumatoid arthritis
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood