rs7798414 chr7:103719333 T>C
- Sequence
ctttccctgtcctttcaagtgact[T/C]gggttgttggcagggattctcctt
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | -0.06 | 1.04 | 1.38 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, fasting insulin, hdl cholesterol, homa-b, ldl cholesterol, total cholesterol