rs779905 chr3:10226333 C>T
- Sequence
ctgctgcctggctgtgtgcacgag[C/T]gtctgaaccatgctaactcacgtt
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma) SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 2.44 | 3.52 | 1.75 | 0.71 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
