rs7802944 chr7:7439013 A>T
- Sequence
gatgagtcgtggagaatgagctgt[A/T]tctatgctatgtctaaacatgacc
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 0.04 | 1.84 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), barnes akathisia rating scale, height, refractive error, urinary albumin-to-creatinine ratio