rs7803075 chr7:131057307 A>G
- Sequence
gaactgcgctcctggatcttttac[A/G]taactgtggtttttcacaaggttc
- ASB in cell types
- CD14+ monocytes Th1-cells breast tumor upper lobe of left lung
- ASB for transcription factors
- STAT1_HUMAN TBX21_HUMAN SKI_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -2.21 | 3.00 | 2.00 | n/a | No Hit | |||
| TBX21_HUMAN | -0.51 | 1.63 | 1.00 | n/a | No Hit | |||
| SKI_HUMAN | 2.27 | -2.27 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, eye color, height, hip bone mineral density (bmd), microalbuminuria, serum creatinine, urinary albumin-to-creatinine ratio