rs7803611 chr7:6016075 T>C
- Sequence
tgatcacaggccaactttcagaac[T/C]gtgactgcccaagtacaaaaatcc
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | 1.55 | -0.16 | 1.25 | -1.81 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, docetaxel response in lymphoblastoid cell lines, fasting blood glucose, prop taste detection threshold, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid