rs7804765 chr7:156764343 T>G
- Sequence
ttttatcagttctatatgatgctt[T/G]tcttcacattatatagaattttca
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 3.76 | 0.81 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.93 | 1.10 | 1.45 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Esophagus_Gastroesophageal_Junction, Liver, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg