rs7806216 chr7:105655162 G>A
- Sequence
aaggttggctgcatttacacccaa[G/A]gagctgtccattgtccttaccttt
- ASB in cell types
- CRC107 (colorectal cancer metastatic stem cells) WA01 (H1, human embryonic stem cells) PFSK1 (primitive neuroectodermal tumor)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 2.97 | -3.05 | 1.62 | -2.79 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
