rs7806345 chr7:145029551 G>C
- Sequence
ctgggagaacaggaagcttcagtt[G/C]catagcaacagagggataagtgat
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.35 | 0.11 | 1.30 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI coronary artery calcified atherosclerotic plaque (90 or 130 hu threshold) in type 2 diabetes
GRASP birth weight, fasting blood glucose, fasting insulin, hdl cholesterol, hdl cholesterol change with statins, homa-ir, infant head circumference, ldl cholesterol, obesity with early age of onset (age >2)