rs7807465 chr7:103851782 T>C
- Sequence
ggcattaattgctcaccaaatagc[T/C]gtatgctcctacacattatccagc
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | -0.42 | 2.08 | 2.60 | -1.48 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
