rs7808571 chr7:112084852 A>C
- Sequence
ggctttctgctgggtgttttcacc[A/C]ttatcacttcaagttaaccacaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- ESR1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.14 | 2.02 | 1.91 | n/a | No Hit | |||
| SPI1_HUMAN | 2.42 | -0.34 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, microalbuminuria, refractive error, simpson-angus scale, tardive dyskinesia, triglycerides