rs7809769 chr7:105601200 A>C
- Sequence
tctctcctcccttgaaaaacaaaa[A/C]acacaaaatccaaagcctccctcg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | -1.12 | 2.20 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, height, homa-ir, hypertension (early onset hypertension), irritible bowel syndrome, late onset alzheimers disease, primary rhegmatogenous retinal detachment, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, schizophrenia, systolic blood pressure (sbp)