rs7810039 chr7:50615175 G>A
- Sequence
ccggatattcaagataaaaagcag[G/A]agaaaatctataacccaaaggtca
- ASB in cell types
- SNU-16 (Gastric adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SNU-16 (Gastric adenocarcinoma) | 2.58 | -1.59 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), fasting insulin, height, homa-b, homa-ir, mitral annular calcium, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid