rs7810536 chr7:140055019 T>C
- Sequence
tcctttctcaactctcgctgtcca[T/C]tcaattcactaggagacccattta
- ASB for transcription factors
- NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | -2.80 | 1.93 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, biploar disorder (bipolar schizoaffective disorder), sporadic creutzfeldt-jakob disease, triglycerides, waist hip ratio
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood