rs7810587 chr7:24820343 A>C
- Sequence
gagatgtaacagcgtgcaatgctg[A/C]actgaaggaaaaacttctttagtt
- ASB in cell types
- PC9 (lung adenocarcinoma) A549 (lung carcinoma) erythroid progenitors HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 1.29 | n/a | 4.00 | |||
| A549 (lung carcinoma) | 0.41 | 0.89 | 2.00 | |||
| erythroid progenitors | 2.40 | -1.31 | 2.00 | |||
| HS-SY-2(Monophasic synovial sarcoma) | -0.75 | 2.08 | 2.00 |
Items per page:
1 – 4 of 4