rs7814445 chr8:19112369 A>G
- Sequence
aatacactgagaacaatgcctata[A/G]taagtgccagctgttgttattatt
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 2.73 | -0.12 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, fasting blood glucose, late onset alzheimers disease, ldl cholesterol, total cholesterol, years of education