rs781517 chr2:64040256 T>C
- Sequence
attaccaaattaatcaaaacactt[T/C]tgccctaagaaaaaaagtttttgt
- ASB in cell types
- monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 3.12 | n/a | 2.25 | 4.35 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
