rs7815609 chr8:2086999 C>A
- Sequence
agacgttgtatattgcagttctgc[C/A]atcacgtatatgtatgtaacctac
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | n/a | 2.93 | 3.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -1.46 | 1.93 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, maternal transmission distortion, plasma brain natriuretic peptide (bnp), transmission distortion, triglycerides, years of education