rs7816194 chr8:132052249 T>G
- Sequence
aatgtagactttcaggcagggagg[T/G]agacttgtgacttcagttccattt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM02610 (Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -0.27 | 2.53 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -1.44 | 1.72 | 1.00 | |||
| foreskin keratinocyte | 1.38 | -0.73 | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP college completion, hip bone mineral density (bmd), hypertension (early onset hypertension), late onset alzheimers disease, ldl cholesterol, primary rhegmatogenous retinal detachment, salmonella-induced pyroptosis, spine bone mineral density (bmd), years of education