rs7816392 chr8:37613869 G>C
- Sequence
cccaggtctggtcccttccctgca[G/C]agtcccccaactgttctcgaggca
- ASB for transcription factors
- ZIC2_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.98 | -5.32 | 2.00 | -5.16 | Concordant | |||
| PKNX1_HUMAN | 2.56 | -4.79 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd