rs7822931 chr8:118712554 G>A
- Sequence
cttagatcttggcaacgagatgag[G/A]cacggggcaggagggcagtgacct
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) KMS-11 (Plasma cell myeloma) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 3.02 | -2.43 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | 0.12 | 1.55 | 1.50 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.57 | -0.37 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -3.65 | 2.03 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), microalbuminuria, rheumatoid arthritis, urinary albumin-to-creatinine ratio