rs7824074 chr8:127576577 T>G
- Sequence
caccagttcctgttcacaaccaag[T/G]ccccttctcctttcccagtcttcc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.08 | 1.11 | 1.00 | |||
| MDM(monocyte derived macrophages) | 2.42 | 2.22 | 2.20 | |||
| monocyte-derived macrophages from peripheral blood | n/a | 2.82 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, college completion, ldl cholesterol change with statins, paternal transmission distortion, total cholesterol change with statins, triglycerides, years of education