rs7824384 chr8:10825815 A>C
- Sequence
tgaaaaaacaccatgcagctaaaa[A/C]tgttgggcaagaaattaaaattat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 2.46 | -2.49 | 1.00 | |||
| spleen | 1.81 | -1.50 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), hdl cholesterol, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients, triglycerides, triglycerides change with statins, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Thyroid