rs7824634 chr8:105940103 C>T
- Sequence
cacgacgtctcttcactaagagtt[C/T]gtgttctgttttcatttaaaattc
- ASB in cell types
- foreskin keratinocyte 2588 (Lymphoblastoid Cell Lines) adrenal gland HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.05 | 0.85 | 1.24 | n/a | No Hit | |||
| STAG1_HUMAN | 1.31 | 0.03 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2