rs7825094 chr8:17610973 T>C
- Sequence
ccatgcatttctctacatggtgag[T/C]gcctatctggaaagtaatcatctg
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -1.15 | 1.82 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, fasting insulin, homa-b, homa-ir, ldl cholesterol, ldl cholesterol change with statins, lp-pla2 activity, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), prop taste detection threshold, total cholesterol, triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid