rs782598 chr2:55620250 T>C
- Sequence
gatattctatgcatatacaggtaa[T/C]tatatgtagatatgtatgtagtgg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 1.90 | -1.90 | 1.00 | |||
| foreskin keratinocyte | -1.07 | 1.76 | 1.39 |
Items per page:
1 – 2 of 2