rs7826036 chr8:10800310 G>A
- Sequence
aacctgttgctaaacgacactgat[G/A]caatcagatgttaccgcagagttt
- ASB in cell types
- K562 (myelogenous leukemia) MSC (mesenchymal stem cells)
- ASB for transcription factors
- RFX1_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 2.90 | -1.50 | 2.00 | n/a | No Hit | |||
| CEBPB_HUMAN | 2.27 | -2.27 | 1.00 | -2.93 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid