rs7826305 chr8:100494077 A>G
- Sequence
tcaaagcctgtgctttgatttgcc[A/G]cctaatcctcctccgttttatatg
- ASB in cell types
- primary B-CLL cells GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -3.83 | 1.95 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hypertension (early onset hypertension), longstanding arthritis, neuroblastoma (brain cancer), rheumatoid arthritis, triglycerides