rs7828449 chr8:8670696 G>C
- Sequence
cctgaagtcgactatgaggtctgg[G/C]cttttgagagaatgaagtaccaac
- ASB in cell types
- hepatocytes AG04450 (fibroblasts) KMS-11 (Plasma cell myeloma) BE2C
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -0.46 | 1.54 | 1.00 | |||
| AG04450 (fibroblasts) | 2.36 | -2.38 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | 0.98 | -3.48 | 2.00 | |||
| BE2C | 2.27 | n/a | 1.00 |
Items per page:
1 – 4 of 4