rs7830049 chr8:3783249 T>C
- Sequence
atggtcaggccgatactgtgtagg[T/C]gctcccggaaaaactggttttttg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 2.41 | 0.34 | 2.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol change with statins, ldl cholesterol, total cholesterol, triglycerides change with statins