rs783020 chr17:74638149 A>T
- Sequence
tttatcttaagtcaaatgcagatt[A/T]actgagctgcacacaagacatcat
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | n/a | 3.45 | 2.50 | |||
| monocyte-derived macrophages from peripheral blood | -5.17 | 3.09 | 2.00 |
Items per page:
1 – 2 of 2