rs783026 chr15:31129473 T>C
- Sequence
actcagctctctgctgcccccacc[T/C]ggccgcctccagtgccgacctgat
- ASB in cell types
- foreskin keratinocyte T47D (invasive ductal carcinoma) right atrium auricular region human villous mesenchymal fibroblast cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.36 | n/a | 2.67 | |||
| T47D (invasive ductal carcinoma) | 0.39 | 0.82 | 2.00 | |||
| right atrium auricular region | 2.56 | -2.18 | 1.00 | |||
| human villous mesenchymal fibroblast cells | 3.01 | n/a | 2.00 | |||
| kidney | 2.02 | n/a | 2.50 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, aortic valve calcium, common carotid artery thickness (average of near and far wall measures), obesity with early age of onset (age >2), salmonella-induced pyroptosis, serum creatinine, sporadic creutzfeldt-jakob disease