rs783027 chr15:31129521 T>C
- Sequence
tactcagctgtagtttgtcaactt[T/C]ctgaaaaatacatgaaattgctgc
- ASB in cell types
- THP-1 (acute monocytic leukemia) CD34+ stem cells-derived erythroblasts K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.76 | 1.05 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 3.01 | -0.61 | 2.00 | |||
| K562 (myelogenous leukemia) | -0.04 | 0.80 | 1.98 |
Items per page:
1 – 3 of 3