rs7830329 chr8:12977259 T>G
- Sequence
tactaatgctggtcgatggagcac[T/G]cagcagtgccaatcacaagatcag
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -0.16 | 1.62 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, arthritis including non-rheumatoid, comorbid depressive syndrome and alcohol dependence, stabilized warfarin dose, tetrology of fallot
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid