rs7831094 chr8:80141042 A>G
- Sequence
ggatgaaccacaccacccagtgtt[A/G]gcaacacgtggatcatctgtggct
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.35 | 0.35 | 1.14 | 0.09 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood