rs7831988 chr8:132051991 A>G
- Sequence
aaaatgttttgtggcctaaacaaa[A/G]caggctgattgtggtttgaaggtg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) HeLa (cervical adenocarcinoma) MCF7L-P(immortalized breast epithelial cell line) PC9 (lung adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.84 | 0.44 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hypertension (early onset hypertension), maternal transmission distortion, microalbuminuria, obesity with early age of onset (age >2), salmonella-induced pyroptosis, serum creatinine