rs7832163 chr8:142295441 T>C
- Sequence
ctcactcttgggtggccgctctgc[T/C]cctctaacacccctgtgtatgcag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 2.07 | -1.75 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.00 | -1.42 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Ovary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid