rs7833037 chr8:42140877 C>A
- Sequence
ttaccgcccagtccccgcggccgg[C/A]gcaagaactcctcgccgggcccca
- ASB in cell types
- MM1.S (plasma cell myeloma) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | -0.21 | 1.81 | 1.20 | |||
| primary B-CLL cells | 1.71 | n/a | 3.00 |
Items per page:
1 – 2 of 2