rs7834206 chr8:32548630 C>A
- Sequence
tcagcgcggccgctcgctctcccc[C/A]tcgagggacaaacttttcccaaac
- ASB in cell types
- foreskin keratinocyte bipolar neuron IPSC-derived bipolar neuron HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.21 | 2.83 | |||
| bipolar neuron | -1.30 | 1.49 | 1.00 | |||
| IPSC-derived bipolar neuron | -1.07 | 1.65 | 1.00 | |||
| HMEC (human mammary epithelial cells) | 0.31 | 1.67 | 1.00 |
Items per page:
1 – 4 of 4