rs7834418 chr8:143532345 C>T
- Sequence
gggagggaggcggcagcagggctg[C/T]ctggcagctttcagaagcccctgt
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) K562 (myelogenous leukemia) HeLa (cervical adenocarcinoma) KB (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 0.25 | 1.42 | 2.27 | |||
| K562 (myelogenous leukemia) | 0.15 | 0.88 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | 0.20 | 1.42 | 3.00 | |||
| KB (cervical adenocarcinoma) | -0.24 | 2.23 | 2.00 | |||
| A549 (lung carcinoma) | 0.68 | 0.70 | 1.07 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood