rs787447 chr10:42753729 G>T
- Sequence
agaggccccgcatgcctgccaggc[G/T]cccgagcccacgcagtccaggttt
- ASB in cell types
- epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -2.45 | 2.39 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Pancreas, Thyroid