rs78900266 chr1:156677793 T>G
- Sequence
ctcagtttcctcatccataaaatg[T/G]gagcaatgatggaaatcgcatggc
- ASB in cell types
- HepG2 (hepatoblastoma) thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.29 | 1.17 | 2.43 | |||
| thoracic aorta | -1.64 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2