rs78983061 chr10:69222386 C>A
- Sequence
atcacttgttgattagattcagag[C/A]cctctactggctacttaaggaggc
- ASB in cell types
- LNCaP (prostate carcinoma) GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.88 | 0.35 | 2.01 | -3.91 | Concordant | |||
| STAG1_HUMAN | 2.52 | -2.75 | 2.22 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
